View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_high_4 (Length: 569)
Name: NF14379_high_4
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 9e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 9e-90
Query Start/End: Original strand, 240 - 435
Target Start/End: Original strand, 13557550 - 13557745
Alignment:
| Q |
240 |
ttatattgcagctggatgggaaaatagttgcacctgctaagggagcattgaaggataagtcatattggattaggatccaatatataaaccatctcacaat |
339 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13557550 |
ttattttgcagctggatgggaaaatagttgcacctgctaagggagcattgaaggataagtcatattggattaggatccaatatataaaccatctcacaat |
13557649 |
T |
 |
| Q |
340 |
agatggtggaataggtggatcaattgatggttatggttctacttggtggcaatgcaaatcttgctttcgacctacggtatgattattcctttttta |
435 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| |||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13557650 |
agatggtggaataggtggatcaattgagggctatggctctacttggtggcagtgcaaaacttgctctcgacctacggtatgattattcctttttta |
13557745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University