View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_low_11 (Length: 337)
Name: NF14379_low_11
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 28164921 - 28165166
Alignment:
| Q |
1 |
tgatcatattttctacttttttatctggtggtatgtccaaaagttacttttatatctcttttgatcagaaagttttaaattctannnnnnnnn---gtcc |
97 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28164921 |
tgatcatattttctacttctttatctggtggtatgtccaaaagttacttttatatctcttttgatcagaaagttttaaattcttttttttttttttgtcc |
28165020 |
T |
 |
| Q |
98 |
ctcctcgttagagaaagagactttgttatcgttttggtttagtgattgatatcctcctccacccaatggattgattaattgcaacccaatctattggtta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28165021 |
ctcctcgttagagaaagagactttgttatcgttttggtttagtgattgatatcctcctccacccaatggattgattaattgcaacccaatctattggtta |
28165120 |
T |
 |
| Q |
198 |
aagattctaagaaaatggtttattttatataggactaaaagttaaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28165121 |
aagattctaagaaaatggtttattttatataggattaaaagttaaa |
28165166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University