View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_low_13 (Length: 315)
Name: NF14379_low_13
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 239 - 300
Target Start/End: Original strand, 7450322 - 7450383
Alignment:
| Q |
239 |
ctctttctgccaaagtggcatccttagagatgtgggtcaaggaaattgaaaatgacatttct |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450322 |
ctctttctgccaaagtggtatccttagagatgtgggtcaaggaaattgaaaatgacatttct |
7450383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 239 - 300
Target Start/End: Original strand, 7458464 - 7458525
Alignment:
| Q |
239 |
ctctttctgccaaagtggcatccttagagatgtgggtcaaggaaattgaaaatgacatttct |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7458464 |
ctctttctgccaaagtggtatccttagagatgtgggtcaaggaaattgaaaatgacatttct |
7458525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University