View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_low_19 (Length: 208)
Name: NF14379_low_19
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_low_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 29234270 - 29234080
Alignment:
| Q |
18 |
ccttcaacacgttttcttataattttgttacatggttgatcatcttgttttcaacatgcttcctgatcatgccaatgtctttgaacatgcattgttatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29234270 |
ccttcaacacgttttcttataattttgttacatggttgatcatcttgttttcaacatgcttcctgatcatgccaatgtctttgaacatgcattgttatga |
29234171 |
T |
 |
| Q |
118 |
tttctttggcttttaacatgccaattggtacattatgccttgtatgtgttgtcaatttgagattatggaaaatagtggttttccttctggc |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29234170 |
tttctttggcctttaacatgccaattggtacattatgccttgtatgtgttgtcaatttgagattatggaaaatagtggttttccttctggc |
29234080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University