View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14379_low_8 (Length: 383)
Name: NF14379_low_8
Description: NF14379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14379_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0242 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 312 - 383
Target Start/End: Original strand, 13082727 - 13082798
Alignment:
| Q |
312 |
ctgcaaaacattctaaaaagatacatagtcaagatgcctgtcaaggaaatggtggaacaaagggtttagcca |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13082727 |
ctgcaaaacattctaaaaagatacatagtcaagatgcctgtcaaggaaatggtggaacaaagggtttagcca |
13082798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 12790 - 12754
Alignment:
| Q |
140 |
gcgggttgcgggacttggtagtatagtgcccataccc |
176 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12790 |
gcgggttgcgggactgggtagtacagtgcccataccc |
12754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 21625 - 21589
Alignment:
| Q |
140 |
gcgggttgcgggacttggtagtatagtgcccataccc |
176 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21625 |
gcgggttgcgggactgggtagtacagtgcccataccc |
21589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 7583692 - 7583728
Alignment:
| Q |
140 |
gcgggttgcgggacttggtagtatagtgcccataccc |
176 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7583692 |
gcgggttgcggggctgggtagtatagtgcccataccc |
7583728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 6336992 - 6336956
Alignment:
| Q |
140 |
gcgggttgcgggacttggtagtatagtgcccataccc |
176 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
6336992 |
gcgggttgcggggctgggtagtatagtgcccataccc |
6336956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 227 - 259
Target Start/End: Complemental strand, 28956467 - 28956435
Alignment:
| Q |
227 |
cgggtatccatcgggcctggatccaattgtcat |
259 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
28956467 |
cgggtgtccatcgggcctggatccaattgtcat |
28956435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University