View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1437_high_13 (Length: 240)
Name: NF1437_high_13
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1437_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 92 - 238
Target Start/End: Complemental strand, 6055575 - 6055428
Alignment:
| Q |
92 |
gagataatttgatctcaatcaatagtatttaaaaagatatcatttaacccgtataatagaaaaa-ctactttatctttctcaatgatcaaatttagtaat |
190 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6055575 |
gagataatttggtctcaagcaatagtatttaaaaagatatcatttaacccgtataatagaaaaaactactttatttttctcaatgatcaaatttagtaat |
6055476 |
T |
 |
| Q |
191 |
atagcttttttaataactaaaataagttttcactctttattatctttt |
238 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6055475 |
atagctcatttaataactaaaatgagttttcactctttattatctttt |
6055428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University