View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1437_low_11 (Length: 291)
Name: NF1437_low_11
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1437_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 168 - 275
Target Start/End: Original strand, 51376705 - 51376812
Alignment:
| Q |
168 |
ctctcttttttccttgtttagtggtgttgtgtttaccctatacgtctatggttgtggccacactacactatgtttttctcgaaggaatatacagtgagtg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376705 |
ctctcttttttccttgtttagtggtgttgtgtttaccctatacgtctatggttgtggccacactacactatgtttttctcgaaggaatatacagtgagtg |
51376804 |
T |
|
| Q |
268 |
gtctttgt |
275 |
Q |
| |
|
|||||||| |
|
|
| T |
51376805 |
gtctttgt |
51376812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 77 - 121
Target Start/End: Original strand, 51376608 - 51376652
Alignment:
| Q |
77 |
tagtgagtcttttacgttacacactgactagtacttagttcgtgg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376608 |
tagtgagtcttttacgttacacactgactagtacttagttcgtgg |
51376652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University