View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1437_low_16 (Length: 236)
Name: NF1437_low_16
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1437_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 50117862 - 50117695
Alignment:
| Q |
17 |
ctggctagtcatgatccccttgtattgtactatcttattcaactggttagatagaacatataagcaattcaaagttctgatctcctttctacttctaggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117862 |
ctggctagtcatgatccccttgtattgtactatcttattcaactggttagatataacatataagcaattcaaagttctgatctcctttctacttctaggc |
50117763 |
T |
|
| Q |
117 |
ttttttcactaaaatcttaaagaaaacctctatatgaaccaatcatatgcctcttccatatcaatata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117762 |
ttttttcactaaaatcttaaagaaaacctctatatgaaccaatcatatgcctcttccatatcaatata |
50117695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 50117651 - 50117609
Alignment:
| Q |
179 |
aatatatgcatgctgatgttggaaaataacttgtgacaattat |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117651 |
aatagatgcatgctgatgttggaaaataacttgtgacaattat |
50117609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University