View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1437_low_7 (Length: 324)

Name: NF1437_low_7
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1437_low_7
NF1437_low_7
[»] chr7 (2 HSPs)
chr7 (13-311)||(6054846-6055147)
chr7 (21-96)||(48926624-48926699)
[»] chr5 (3 HSPs)
chr5 (13-95)||(4308723-4308805)
chr5 (13-95)||(4312554-4312636)
chr5 (21-95)||(30364369-30364443)
[»] chr3 (1 HSPs)
chr3 (21-99)||(26286771-26286849)
[»] chr1 (1 HSPs)
chr1 (13-95)||(42321475-42321557)
[»] chr8 (4 HSPs)
chr8 (13-93)||(20112825-20112905)
chr8 (21-96)||(9528908-9528983)
chr8 (20-94)||(35916268-35916342)
chr8 (21-93)||(35911187-35911259)
[»] chr4 (6 HSPs)
chr4 (20-95)||(38843709-38843784)
chr4 (21-95)||(41303623-41303697)
chr4 (21-94)||(52208007-52208080)
chr4 (21-96)||(38584093-38584168)
chr4 (21-95)||(27972657-27972731)
chr4 (21-94)||(37235943-37236016)


Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 311
Target Start/End: Complemental strand, 6055147 - 6054846
Alignment:
13 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttgggaacttttctca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6055147 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttgggaacttttctca 6055048  T
113 ggaattgtatttaactgctatttggtt-ttgtcgataacggacgtcgagatttaatattgtgaaatatcgggtatatgaatgaatatccgatttgtctaa 211  Q
    |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6055047 ggaattgtatttaactgctatttgtttcttgtcgataacggacgtcgagatttaatattgtgaaatatcgggtatatgaatgaatatccgatttgtctaa 6054948  T
212 aagatgttaatttttccatcagc--nnnnnnnnnttgttaagttttattgattatagaatgattgaactcattgaaggataaattacagatcatgaagtt 309  Q
    |||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6054947 aagatgttaatttttccatcagcaaaaaaaaaacttgttaagttttattgattatagaatgattgaactcattgaaggataaattacagatcatgaagtt 6054848  T
310 at 311  Q
    ||    
6054847 at 6054846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 48926699 - 48926624
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg 96  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||    
48926699 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctaaccaactagactacaacggattg 48926624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 4308805 - 4308723
Alignment:
13 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4308805 aaaatgatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 4308723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 4312636 - 4312554
Alignment:
13 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4312636 aaaatgatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 4312554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 30364443 - 30364369
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30364443 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 30364369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 26286849 - 26286771
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttg 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26286849 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttg 26286771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 42321557 - 42321475
Alignment:
13 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42321557 aaaaaaatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 42321475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 20112905 - 20112825
Alignment:
13 aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga 93  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20112905 aaaataaattccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga 20112825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 9528908 - 9528983
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg 96  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||    
9528908 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggattg 9528983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 35916342 - 35916268
Alignment:
20 tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat 94  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||    
35916342 tttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggat 35916268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 93
Target Start/End: Complemental strand, 35911259 - 35911187
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga 93  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||    
35911259 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacgga 35911187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 20 - 95
Target Start/End: Original strand, 38843709 - 38843784
Alignment:
20 tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38843709 tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 38843784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 41303623 - 41303697
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41303623 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 41303697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 52208080 - 52208007
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52208080 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat 52208007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 38584093 - 38584168
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg 96  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||    
38584093 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggattg 38584168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 27972657 - 27972731
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt 95  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||    
27972657 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggatt 27972731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 37236016 - 37235943
Alignment:
21 ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat 94  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||    
37236016 ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggat 37235943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University