View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1437_low_7 (Length: 324)
Name: NF1437_low_7
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1437_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 311
Target Start/End: Complemental strand, 6055147 - 6054846
Alignment:
| Q |
13 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttgggaacttttctca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6055147 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttgggaacttttctca |
6055048 |
T |
 |
| Q |
113 |
ggaattgtatttaactgctatttggtt-ttgtcgataacggacgtcgagatttaatattgtgaaatatcgggtatatgaatgaatatccgatttgtctaa |
211 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6055047 |
ggaattgtatttaactgctatttgtttcttgtcgataacggacgtcgagatttaatattgtgaaatatcgggtatatgaatgaatatccgatttgtctaa |
6054948 |
T |
 |
| Q |
212 |
aagatgttaatttttccatcagc--nnnnnnnnnttgttaagttttattgattatagaatgattgaactcattgaaggataaattacagatcatgaagtt |
309 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6054947 |
aagatgttaatttttccatcagcaaaaaaaaaacttgttaagttttattgattatagaatgattgaactcattgaaggataaattacagatcatgaagtt |
6054848 |
T |
 |
| Q |
310 |
at |
311 |
Q |
| |
|
|| |
|
|
| T |
6054847 |
at |
6054846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 48926699 - 48926624
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
48926699 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctaaccaactagactacaacggattg |
48926624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 4308805 - 4308723
Alignment:
| Q |
13 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4308805 |
aaaatgatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
4308723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 4312636 - 4312554
Alignment:
| Q |
13 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4312636 |
aaaatgatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
4312554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 30364443 - 30364369
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30364443 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
30364369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 26286849 - 26286771
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26286849 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattgttg |
26286771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 42321557 - 42321475
Alignment:
| Q |
13 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42321557 |
aaaaaaatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
42321475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 20112905 - 20112825
Alignment:
| Q |
13 |
aaaataatttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20112905 |
aaaataaattccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga |
20112825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 9528908 - 9528983
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9528908 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggattg |
9528983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 35916342 - 35916268
Alignment:
| Q |
20 |
tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35916342 |
tttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggat |
35916268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 93
Target Start/End: Complemental strand, 35911259 - 35911187
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacgga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35911259 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacgga |
35911187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 20 - 95
Target Start/End: Original strand, 38843709 - 38843784
Alignment:
| Q |
20 |
tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38843709 |
tttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
38843784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 41303623 - 41303697
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41303623 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
41303697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 52208080 - 52208007
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52208080 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat |
52208007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 38584093 - 38584168
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38584093 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggattg |
38584168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 27972657 - 27972731
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27972657 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggatt |
27972731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 37236016 - 37235943
Alignment:
| Q |
21 |
ttccgttgccgggacttgaacccgggtctttcgggtgagagccgaatatcctgaccaactagactacaacggat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37236016 |
ttccgttgccgggacttgaacccgggtctctcgggtgagagccgagtatcctgaccaactagactacaacggat |
37235943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University