View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1437_low_8 (Length: 321)
Name: NF1437_low_8
Description: NF1437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1437_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8872660 - 8872424
Alignment:
| Q |
1 |
atgaggtaaaggcagaaaacaaatcagaagcagcagatataaaagtgacattgattcaaacccatgtgaacttgaaaattgagtgcnnnnnnnnggctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8872660 |
atgaggtaaaggcagaaaacaaatcagaagcagcagatataaaagtgacattgattcaaacccatgtgaacttgaaaattgagtgcaaaaaaaaggctgg |
8872561 |
T |
 |
| Q |
101 |
tcaattgataaaggttattgttgctttggaaaatcttaggctaactattcttcacctaaacatcacatcttttgagtcttctgtactctactccttcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8872560 |
tcaattgataaaggttattgttgctttggaaaatcttaggctaactattcttcacctaaacatcacatcttttgagtcttctgtactctactccttcaat |
8872461 |
T |
 |
| Q |
201 |
ctcaaggtattattctgtcttttcactcatcatagtg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8872460 |
ctcaaggtattattctgtcttttcactcatcatagtg |
8872424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 305
Target Start/End: Complemental strand, 8872402 - 8872367
Alignment:
| Q |
270 |
aaaattggtcaactcactatggtatcaagtcagagt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8872402 |
aaaattggtcaactcactatggtatcaagtcagagt |
8872367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University