View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14380_high_5 (Length: 339)
Name: NF14380_high_5
Description: NF14380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14380_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 41 - 339
Target Start/End: Original strand, 16195369 - 16195664
Alignment:
| Q |
41 |
aaagagagcaattttgaggtgttcattgaataaccatnnnnnnntctagtgaacctaaaaggaaccttacgacaatccgggtatgggctcgtattggatt |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16195369 |
aaagagagcaattttgaggtgtttattgaataatcataaaaa--tctagtgaacctaaaaggaaccttacgacaatccgggtatgggctcgtattgtatt |
16195466 |
T |
 |
| Q |
141 |
attgatctatatagtacatgagatcctaataaaggctcacaacttgtgcaattaaataaactagacctaaagataattgctctttaaggtctatattggt |
240 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16195467 |
attgatctatatagtacatgagatcttaataaaggctcacaacttgtgcaattaaataaactagatctaaagataattgctcttt-aggtctatattggt |
16195565 |
T |
 |
| Q |
241 |
ttgaagctctcttgatttattagaagatattttttcgatgtatctttttactctttttgcccatcgaaagatatctttcgatgatgtattttgtctgtg |
339 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16195566 |
ttgaagctctcccgatttattagaagatattttttcgatgtatctttttactctttttgcccatcgaaagatatctttcgatgatgtattttgtctgtg |
16195664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University