View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14380_high_6 (Length: 324)
Name: NF14380_high_6
Description: NF14380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14380_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 317
Target Start/End: Original strand, 9400482 - 9400781
Alignment:
| Q |
18 |
atttattggattacaccatacgaagtacaaaattgcagatgaagcttgtatataataactaagattatgtcgtttggcaattggcacattaacataacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9400482 |
atttattggattacaccatacgaagtacaaaattgcagatgaagcttgtatataataactaagattatgtcgtttggtaattggcacattaacataacat |
9400581 |
T |
 |
| Q |
118 |
actaacagaatcaacgttaaaaagtaacttaattagttaattatgatatatgtggatggtggtgaatatgtatattattaagcaataaaggtcttcttta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
9400582 |
actaacagaatcaacgttaaaaagtaacttaattagttaattatgatatatgtggatggtggtgaatatgtatattattaagcaacaaaggtcttattta |
9400681 |
T |
 |
| Q |
218 |
aaggttaaaataattcattttgcatgtcgaatcaaatctttagaaagtaaataagaatattgtgaggtctagataatgcttctattttttatattcttgg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9400682 |
aaggttaaaataattcattttgcatgtcgaatcaaatctttagaaagtaaataagaatattgtgaggtctagataatgcttctattttttatattgttgg |
9400781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University