View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_10 (Length: 358)
Name: NF14381_low_10
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 30550878 - 30550706
Alignment:
| Q |
1 |
gaaattgtttcaatagctgaagaagaagatgatgatactagtgatcaaaattaaattccacttgtaattaatgtttttatcaatatataaaacttgatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30550878 |
gaaattgtttcaatagctgaagaagaagatgatgatactagtgatcaaaattaaattccacttgtaat----gtttttatcaatatataaaacttgatct |
30550783 |
T |
 |
| Q |
101 |
ttaagcaatgtctatatatgattgcatttatgttgtaaacttgtaacagc----aatctattatcagataagtaata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
30550782 |
ttaagcaatgtctatatatgattgcatttatgttgtaaacatgtaacagcaattaatctattatcagataagtaata |
30550706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University