View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_12 (Length: 332)
Name: NF14381_low_12
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 25460082 - 25460387
Alignment:
| Q |
1 |
tcaataacaaggagtgtttccaatactatcgttactgagatttcattcaagcttcatttcagtctcttaaaatgtgcatgattgattaggcgtttgccta |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25460082 |
tcaattacaaggagtgtttccaatactatcgttactgagatttcattcaagcttcatttcagtctcttaaaatgtgcatgattgattaggcgtttgccta |
25460181 |
T |
|
| Q |
101 |
catttaggataactatcatcatcagagatatgcatcttatatcgttcagcatttttcaactacctgttattggccaccttccaaagaaatgctcaagtt- |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25460182 |
catttaggataactatcatcatcagagatatgcatcttatatcgttcagcatttttcaactacctgttattggccaccttccaaagaaatgctcaagtta |
25460281 |
T |
|
| Q |
200 |
--ataaagaccaaaaaaggtttgatacgtattcttattttagacgtatcgaacactacatgtatatgtggatatctctcacaggataaggagtttaaaca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25460282 |
taataaagaccaaaaaaggtttgatacgtattcttattttagacgtatcgaacactacatgtatatgtggatatctctcataggataaggagtttaaaca |
25460381 |
T |
|
| Q |
298 |
cttgct |
303 |
Q |
| |
|
|||||| |
|
|
| T |
25460382 |
cttgct |
25460387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University