View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_18 (Length: 271)
Name: NF14381_low_18
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 37762475 - 37762223
Alignment:
| Q |
1 |
ctccagatctggaaatatagttaataagatttcagtttttcaagaactgcaaatctgtgacatttggagttttaattttctggatctgcactcatctggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762475 |
ctccagatctggaaatatagttaataagatctcagtttttcaagaactgcaaatctgtgacatttggagttttaattttctggatctgcactcatctggt |
37762376 |
T |
|
| Q |
101 |
ttattattataatatcatatcatacatcagatagccagattgtttggtatttttataatcaattagcatttaggtacttaattaattgttatttcatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762375 |
ttattattataatatcatatcatacagcagatagccagattgtttggtatttttataatcaattagcatttaggtacttaattaattgttatttcatcta |
37762276 |
T |
|
| Q |
201 |
ttcatgtggataacatataaaacctaccataaaaattgtcatgaattaggttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762275 |
ttcatgtggataacatataaaacctaccataaaaattgtcatgaattaggttc |
37762223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University