View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_23 (Length: 242)
Name: NF14381_low_23
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 3527209 - 3526974
Alignment:
| Q |
1 |
tcctaaatcgactgacccattgaagaagnnnnnnnntttgatttttagagga-tattacttttttattttccaattctaccatataa----gtacactac |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3527209 |
tcctaaatcgactgacccattgaagaaaaaaaaaa--ttgatttttagaggaatattacttttttattttccaattctaccatataattaagtacactac |
3527112 |
T |
 |
| Q |
96 |
tttcatcaattcaatttataataataatgagattacatcaatccatgcatttatatcctgatatttcgtaattggaaattttcagcttcttctccaactc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
3527111 |
tttcatcaattcaatttataataataatgagattacatcaatacatgcatttatatcctgatatttccttattggaaattttcagcttcttctccaactc |
3527012 |
T |
 |
| Q |
196 |
ttcccctgtcgtcattgcagcccccaggtaaaatcctc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3527011 |
ttcccctgtcgtcattgcagcccccaggtaaaatcctc |
3526974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University