View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_24 (Length: 237)
Name: NF14381_low_24
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 33393945 - 33394166
Alignment:
| Q |
1 |
cgcctggaatggaacccgcctccaattctccgtacaaaatgtctccaccggagttagtcaaaataaa---gtagttagaaagaccttcaatctaagggtt |
97 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
33393945 |
cgcctggaacggaacccgcctccaattctccgtacagaatgtctccactagagttagtcaaaataaataagtagttagaaagacatccaatctaagggtt |
33394044 |
T |
 |
| Q |
98 |
ttatacgatccatataatgtaaactttttggctccaagagattgagaagattttcaacttttttcaatgtgcagaaaacactaaggtggggtatgccacc |
197 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33394045 |
ttatacgatccatataatgcaggctttttggctctaagagatggagaagattttcaagttttttcaatgtgcagaaaacaccaaggtggggtatgccacc |
33394144 |
T |
 |
| Q |
198 |
tacgtgcctgattggcgaggtc |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33394145 |
tacgtgcctgattggcgaggtc |
33394166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University