View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_25 (Length: 209)
Name: NF14381_low_25
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 25 - 177
Target Start/End: Original strand, 19469184 - 19469328
Alignment:
| Q |
25 |
tgcttgcctaccatttcctatctggtcctttgatcaactctctcacaactctgattccgagtttgatgcggttcttaacaggctaattgcattcctgttt |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19469184 |
tgcttgcctaccatttcctaactggtcctttgatcaac--------aactctgatttcgagtttgatgcggttcttaacaagctaattgcattcctgttt |
19469275 |
T |
 |
| Q |
125 |
attatttcccacgaggctttgttctctctcactccctatttcatcgtgatttg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19469276 |
attatttcccacgaggctttgttctctctcactccctatttcatcgtgatttg |
19469328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 25 - 128
Target Start/End: Complemental strand, 47866278 - 47866183
Alignment:
| Q |
25 |
tgcttgcctaccatttcctatctggtcctttgatcaactctctcacaactctgattccgagtttgatgcggttcttaacaggctaattgcattcctgttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47866278 |
tgcttgcctaccatttcctatctggtcctttgatcaac--------aactctgattccgagtttgatgcggttcttaacaggctaattgcattcctgttt |
47866187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 47866036 - 47865986
Alignment:
| Q |
127 |
tatttcccacgaggctttgttctctctcactccctatttcatcgtgatttg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47866036 |
tatttcccacgaggctttgttctctctcactccctatttcatcgtgatttg |
47865986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University