View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14381_low_4 (Length: 447)
Name: NF14381_low_4
Description: NF14381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14381_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 428; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 1 - 432
Target Start/End: Original strand, 42600333 - 42600764
Alignment:
| Q |
1 |
acaaacgagatgaaggacgtggagtgatgtatgcaagcaacaatgacttgtatagaaccaacgctgccagctggcatgattctctgcaagcgtggatggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600333 |
acaaacgagatgaaggacgtggagtgatgtatgcaagcaacaatgacttgtatagaaccaacgctgccagctggcatgattctctgcaagcgtggatggc |
42600432 |
T |
|
| Q |
101 |
accggaggcaccgaaagccgaggagttgccggagatttgtcgtaaggagatggttgaatgggattttcatgcggccggagttgctgaagtggtttttgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600433 |
accggaggcaccgaaagccgaggagttgccggagatttgtcgtaaggagatggttgaatgggattttcatgcggccggagttgctgaagtggtttttgag |
42600532 |
T |
|
| Q |
201 |
ttgctttctgaaggtttgggattggaacgtggaaagttgaaggagttgagtttttgtgaaacgagggtgattgtgggacattgttatccttattgtcctc |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600533 |
ttgctctctgaaggtttgggattggaacgtggaaagttgaaggagttgagtttttgtgaaacgagggtgattgtgggacattgttatccttattgtcctc |
42600632 |
T |
|
| Q |
301 |
aaccagatttgactatgggtattacaccgcatacagatccttgtgctattactttgttgttgcagaatcaggttccgggattgcaggtgaagtatgaagg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600633 |
aaccagatttgactatgggtattacaccgcatacagatccttgtgctattactttgttgttgcagaatcaggttccgggattgcaggtgaagtatgaagg |
42600732 |
T |
|
| Q |
401 |
tgagtgggttgatgttaacccggttcaaggtg |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42600733 |
tgagtgggttgatgttaacccggttcaaggtg |
42600764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University