View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14382_high_14 (Length: 249)
Name: NF14382_high_14
Description: NF14382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14382_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 83 - 239
Target Start/End: Complemental strand, 56043612 - 56043456
Alignment:
| Q |
83 |
cctgtgtggttaagacgatgaatagagcaaggagaaaactgagagattgtttgtaataagctttcataatagtaatagcaccaatggagtaagcatcacc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043612 |
cctgtgtggttaagacgatgaatagagcaaggagaaaactgagagattgtttgtaataagctttcataatagtaatagcaccaatggagtaagcatcacc |
56043513 |
T |
 |
| Q |
183 |
accaccttgagaaacaccacagttagcaaaaatagtgataataacatgctccttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043512 |
accaccttgagaaacaccacagttagcaaaaatagtgataataacatgctccttcat |
56043456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University