View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14382_high_16 (Length: 222)
Name: NF14382_high_16
Description: NF14382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14382_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 47407310 - 47407500
Alignment:
| Q |
18 |
gaacctgctgctcccactcaccctccgcctcccctgtgggatcctttacggtgccttgattgacaccaccaccctgttcattttgaccagatttaacaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
47407310 |
gaacctgctgctcccactcaccctccgcctcccctgcaggatcctttatggtgccttgattgacatcaccaccctgttcattttgaccagaattaacaga |
47407409 |
T |
 |
| Q |
118 |
aggcagcccatgcaatttagataaatgatgcttttgttgctggtcagtagaaaggtcattaggttctgcggatgattgccaggaatttaaa |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47407410 |
aggcaacccatgcaatttagataaatgatgcttatgttgctgctctgtagaaaggtcattaggttctgctgatgattgccaggaatttaaa |
47407500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 59 - 183
Target Start/End: Original strand, 47390192 - 47390316
Alignment:
| Q |
59 |
tcctttacggtgccttgattgacaccaccaccctgttcattttgaccagatttaacagaaggcagcccatgcaatttagataaatgatgcttttgttgct |
158 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
47390192 |
tcctttacagtgccttgattgataccactaccctgttcattttgaccagaattaacagaaggcaacccatgcaacttagataaatgatgcctatgttgct |
47390291 |
T |
 |
| Q |
159 |
ggtcagtagaaaggtcattaggttc |
183 |
Q |
| |
|
| ||| ||||||||||||||||||| |
|
|
| T |
47390292 |
gctcaatagaaaggtcattaggttc |
47390316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 70 - 144
Target Start/End: Original strand, 47418698 - 47418772
Alignment:
| Q |
70 |
gccttgattgacaccaccaccctgttcattttgaccagatttaacagaaggcagcccatgcaatttagataaatg |
144 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| |||||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
47418698 |
gccttgattgacaccaataccctgttcaatttcaccagagttaacaataggcatcccatgcaatttagataaatg |
47418772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University