View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14382_low_12 (Length: 295)
Name: NF14382_low_12
Description: NF14382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14382_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 276
Target Start/End: Original strand, 52543138 - 52543398
Alignment:
| Q |
16 |
tcaaactcttccaccactctaccttgccaagaattcccaaaacactcgtcgtcaaccaatgattcgcggcgcgccacatgttttgcagccatgacagccg |
115 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
52543138 |
tcaaactcttccaccactctacctttggacgaattcccaaaacactcgtcgtcaaccaatgattcgcggagcgccacatgttttgcagccataacagccg |
52543237 |
T |
 |
| Q |
116 |
tcaattctttgggaatattcaaccgggcagaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543238 |
tcaattctttgggaatattcaaccgggccgaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattg |
52543337 |
T |
 |
| Q |
216 |
agtatagacaaaagggtgttttttgttgaaagtttgaggaggtaagagccattgaagagca |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543338 |
agtatagacaaaagggtgttttttgttgaaagtttgaggaggtaagagccattgaagagca |
52543398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University