View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14382_low_14 (Length: 262)
Name: NF14382_low_14
Description: NF14382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14382_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 44298544 - 44298784
Alignment:
| Q |
1 |
attgtcgatttcatcttcgttccataatcagcctgtcacattaatggaataatttgctcatattgtaaattcttcaatgaaattaaatggaattaataat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44298544 |
attgtcgatttcatcttcgttccataatcagcctgtcacattaatggaataatttgctcatattgtaaattcttcaatgaaattaaatggaat----aat |
44298639 |
T |
 |
| Q |
101 |
cattacctgaagtatgcaaccacccaaacccattccttcaaagagttgatggaagcaaagtgcagcaatgagaggccttatggtgcaatggttctctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298640 |
cattacctgaagtatgcaaccacccaaacccattccttcaaagagttgatggaagcaaagtgcagcaatgagaggccttatggtgcaatggttctctgaa |
44298739 |
T |
 |
| Q |
201 |
gcacccaatgacaaaccaatcactacagagtgcaccacaattcct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298740 |
gcacccaatgacaaaccaatcactacagagtgcaccacaattcct |
44298784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University