View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14382_low_5 (Length: 456)
Name: NF14382_low_5
Description: NF14382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14382_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 22 - 437
Target Start/End: Original strand, 3722171 - 3722581
Alignment:
| Q |
22 |
ttttccaagaaaaaaggtggtggggtttatggtcttgactagttgcaaaagtagagannnnnnngagttcttattaagaaagtgctttttagggagaata |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722171 |
ttttccaagaaaaaaggtggtggggtttatggtcttgactagttgcaaaagtaga--tttttttgagttcttattaagaaagtgctttttagggagaata |
3722268 |
T |
 |
| Q |
122 |
atcatatgcaaattatggtaacaatttgattttgtaaaaaggttgattcttttttgttaggtaagggcttatggtttgttgagatgggttaattgtactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3722269 |
atcatatgcaaattatggtaacaatttgattttgtaaaaaggttgattcttttttgttaggtaagggtttatggtttgttgagatgggttaattgtactt |
3722368 |
T |
 |
| Q |
222 |
tctgctatgatcaaattggaatttttgttttgaatgattgtttgtggatgaaggttttgtatttggataacaacaatagttgaaattgtatggtgatatg |
321 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3722369 |
tctgctatgatcaaattggaattttggttttgaatgattgtttgtggatgaaggttttgtatttggat---aacaatagttgaaattgtatggtgatatg |
3722465 |
T |
 |
| Q |
322 |
atcaaggtttattttatctgcatttgttttagtggagctataatcaatttgattgtattatatagcggttaaagtaggattaactttagttaaacctgtc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3722466 |
atcaaggtttattttatctgcatttgttttagtggagctataatcaatttgattgtattatatagcggttaaagtaggataaacttcagttaaacctgtc |
3722565 |
T |
 |
| Q |
422 |
tatttggatcatggtt |
437 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3722566 |
tatttggatcatggtt |
3722581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University