View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14383_high_2 (Length: 355)
Name: NF14383_high_2
Description: NF14383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14383_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 52926089 - 52926429
Alignment:
| Q |
1 |
gcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926089 |
gcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaacgg |
52926188 |
T |
 |
| Q |
101 |
gagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926189 |
gagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatagca |
52926288 |
T |
 |
| Q |
201 |
aacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattgaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926289 |
aacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattgaat |
52926388 |
T |
 |
| Q |
301 |
cttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926389 |
cttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
52926429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University