View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14384_low_6 (Length: 245)
Name: NF14384_low_6
Description: NF14384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14384_low_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 245
Target Start/End: Complemental strand, 41414537 - 41414308
Alignment:
| Q |
11 |
tagtttaataacgataaacaacagattaattgtctatgcgaagaagtgaaaaaactacatattcaaaacctgctttctaacacatcagatacattaaatg |
110 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41414537 |
tagtttaatagagataatcaacatattaattgtctatgcgaagaagtgaaaaat-tacatattcaaaacctgctttctaacacatcagatacattaaatg |
41414439 |
T |
 |
| Q |
111 |
tctcatgaaaagttcctgcaaccactatgaattgggcatgacaatgataatatatttatttatttttgggaaatattcaagttagcagtactatcaaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41414438 |
tctcatgaaaagttcctgcaaccactatgaattgggcatgaaaatgataata----tatatattattgggaaatattcaagttagcagtactatcaaaca |
41414343 |
T |
 |
| Q |
211 |
agaccgacatcaaagcaacatatagtgagagatca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41414342 |
agaccgacatcaaagcaacatatagtgagagatca |
41414308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University