View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14385_low_2 (Length: 330)
Name: NF14385_low_2
Description: NF14385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14385_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 263 - 314
Target Start/End: Original strand, 13629929 - 13629980
Alignment:
| Q |
263 |
aactctaagttctaagataatcttgcttacaatttcggcaaaggcaccttat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13629929 |
aactctaagttctaagataatcttgcttacaatttcggcaaaggcaccttat |
13629980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University