View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14385_low_7 (Length: 222)

Name: NF14385_low_7
Description: NF14385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14385_low_7
NF14385_low_7
[»] scaffold0114 (1 HSPs)
scaffold0114 (1-208)||(5773-5980)


Alignment Details
Target: scaffold0114 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 5980 - 5773
Alignment:
1 gtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttcagtctat 100  Q
    ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
5980 gtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttcagtctat 5881  T
101 ttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgcttaccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||     
5880 ttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgtttacct 5781  T
201 atgatgtc 208  Q
    ||||||||    
5780 atgatgtc 5773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University