View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14386_high_21 (Length: 238)
Name: NF14386_high_21
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14386_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46961536 - 46961313
Alignment:
| Q |
1 |
ctccaactgcattttcggtgagcttttggtttttcccgatagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46961536 |
ctccaactgcattttcggtgagcttttggtttttcccggtagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaag |
46961437 |
T |
 |
| Q |
101 |
ttta-ggtgggatttgaaccc-cgccttttcagaccagaaccttaatctggcacgctttagaccataattttggaccattctcgatctgtgtgtcatcct |
198 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46961436 |
tttagggtgggatttgaacccacgccttttcagaccagaaccttaatctggcacgctttagaccataattttggaccattctcgatctgtgtgtcatcct |
46961337 |
T |
 |
| Q |
199 |
tacacatggataatcatgatgaat |
222 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
46961336 |
tacacatggacaatcatgatgaat |
46961313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28545569 - 28545524
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
28545569 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
28545524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28549984 - 28549939
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
28549984 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
28549939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28556152 - 28556107
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
28556152 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
28556107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 47958511 - 47958556
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
47958511 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
47958556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 48253928 - 48253883
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
48253928 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
48253883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 33075869 - 33075824
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
33075869 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
33075824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 21127742 - 21127787
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
21127742 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
21127787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 43291871 - 43291916
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
43291871 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
43291916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 36011959 - 36011914
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
36011959 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
36011914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 2736247 - 2736202
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
2736247 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
2736202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 39959915 - 39959870
Alignment:
| Q |
106 |
gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc |
150 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
39959915 |
gtgggatttgaacccacgccctttcggaccagaaccttaatctggc |
39959870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University