View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14386_high_21 (Length: 238)

Name: NF14386_high_21
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14386_high_21
NF14386_high_21
[»] chr7 (6 HSPs)
chr7 (1-222)||(46961313-46961536)
chr7 (106-150)||(28545524-28545569)
chr7 (106-150)||(28549939-28549984)
chr7 (106-150)||(28556107-28556152)
chr7 (106-150)||(47958511-47958556)
chr7 (106-150)||(48253883-48253928)
[»] chr4 (1 HSPs)
chr4 (106-150)||(33075824-33075869)
[»] chr3 (2 HSPs)
chr3 (106-150)||(21127742-21127787)
chr3 (106-150)||(43291871-43291916)
[»] chr2 (1 HSPs)
chr2 (106-150)||(36011914-36011959)
[»] chr1 (2 HSPs)
chr1 (106-150)||(2736202-2736247)
chr1 (106-150)||(39959870-39959915)


Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46961536 - 46961313
Alignment:
1 ctccaactgcattttcggtgagcttttggtttttcccgatagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaag 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46961536 ctccaactgcattttcggtgagcttttggtttttcccggtagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaag 46961437  T
101 ttta-ggtgggatttgaaccc-cgccttttcagaccagaaccttaatctggcacgctttagaccataattttggaccattctcgatctgtgtgtcatcct 198  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46961436 tttagggtgggatttgaacccacgccttttcagaccagaaccttaatctggcacgctttagaccataattttggaccattctcgatctgtgtgtcatcct 46961337  T
199 tacacatggataatcatgatgaat 222  Q
    |||||||||| |||||||||||||    
46961336 tacacatggacaatcatgatgaat 46961313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28545569 - 28545524
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
28545569 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28545524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28549984 - 28549939
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
28549984 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28549939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 28556152 - 28556107
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
28556152 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28556107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 47958511 - 47958556
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
47958511 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 47958556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 48253928 - 48253883
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
48253928 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 48253883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 33075869 - 33075824
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
33075869 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 33075824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 21127742 - 21127787
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
21127742 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 21127787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 43291871 - 43291916
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
43291871 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 43291916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 36011959 - 36011914
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
36011959 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 36011914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 2736247 - 2736202
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
2736247 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 2736202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 39959915 - 39959870
Alignment:
106 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 150  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
39959915 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 39959870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University