View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14386_high_22 (Length: 230)
Name: NF14386_high_22
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14386_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 31533273 - 31533088
Alignment:
| Q |
33 |
gaagaagaagaaggaggagggataactaaaggtttctatgctatctgt--gtgttttagatttagattcactt-ccagtggaatacaaattcaaagtcac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
31533273 |
gaagaagaagaaggaggagggataactaaaggtttctatgctatctgtgtgtgttttagatttagattcacttccctgtggaatacaaattcaaagtcat |
31533174 |
T |
 |
| Q |
130 |
tnnnnnnnnnnnnggatcacaacatcgaaaacacatgtatccgtatcttacaacatcgacgacgtcaaaattattgattgaatttg |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31533173 |
taaaaataaaaaaggatcacaacatcgaaaacacatgtatccgtatcttacaacatcgacgacgtcaaaaccattgattgaatttg |
31533088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University