View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14386_low_11 (Length: 301)
Name: NF14386_low_11
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14386_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 285
Target Start/End: Complemental strand, 32848025 - 32847754
Alignment:
| Q |
14 |
atcttttcctatctcttttatgtattaagaacaccaactctcatctatcaatttaggttcttccgcttatgaatctttttcaagaaaaacgtgtctccct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32848025 |
atcttttcctatctcttttatgtattaagaacaccaactctcatctatcaatttcggttctcccgcttatgaatctttttcaagaaaaacgtgtctccct |
32847926 |
T |
 |
| Q |
114 |
tttgagcctgagcctgttctaagtaataggcaagatattatattctttaggttctgctggtggggaccttgtttgtgtcattttggtactattatgactg |
213 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847925 |
tttgaacctgagcctgttctaggtaataggcaacacattatattctttaggttctgccggtggggaccttgtttgtgtcattttggtactattatgactg |
32847826 |
T |
 |
| Q |
214 |
aaactatgcgtgttgaatcagataatgtggtttagtttatttaggtctaaatgaatgccaatataaaatagg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32847825 |
aaactatgcgtgttgaatcagataatgtggtttagtttatttagatctaaatgaatgccaatataaaatagg |
32847754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 11364601 - 11364555
Alignment:
| Q |
4 |
gtcttcttctatcttttcctatctcttttatgtattaagaacaccaa |
50 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
11364601 |
gtcttcttctatcttttcctttcccttttatgtactaagaacaccaa |
11364555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 139
Target Start/End: Original strand, 17479728 - 17479776
Alignment:
| Q |
91 |
tttcaagaaaaacgtgtctcccttttgagcctgagcctgttctaagtaa |
139 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
17479728 |
tttcaagaaaaaattgtctcccttttgaacctgaacctgttgtaagtaa |
17479776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 50
Target Start/End: Original strand, 564234 - 564280
Alignment:
| Q |
4 |
gtcttcttctatcttttcctatctcttttatgtattaagaacaccaa |
50 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
564234 |
gtcttcttctatcttttcctttctcttttatgcactaagaacaccaa |
564280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 50
Target Start/End: Original strand, 531279 - 531325
Alignment:
| Q |
4 |
gtcttcttctatcttttcctatctcttttatgtattaagaacaccaa |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||| ||||||| |
|
|
| T |
531279 |
gtcttcttctatcttttcctttctcttttatctactaaggacaccaa |
531325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University