View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14386_low_15 (Length: 272)
Name: NF14386_low_15
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14386_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 8893410 - 8893659
Alignment:
| Q |
1 |
acgcaaatgaagctataatttaaactgctttttgttctccacaagttttcttaaaaacccgattccatttggaaatattgttctgcatggaaaaacacgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
8893410 |
acgcaaatgaagctataatttaaactgctttttgttccccacaagttttcttaaaaacccgattccatttggaaatattgttctgcacggaaaaacacag |
8893509 |
T |
 |
| Q |
101 |
ttttgtctaactcactcattcgaggtggaaagaccatgtttttccttatatatttaaaacggtacttccaaacgggtcggttttttaagaaaacacgagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893510 |
ttttgtctaactcactcattcgaggtggaaagaccatgtttttccctatatatttaaaacggtacttccaaacgggtcggttttttaagaaaacacgagg |
8893609 |
T |
 |
| Q |
201 |
atgaaaatagctctcatagcttcatgtatccacatcacaaacaggagcac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8893610 |
atgaaaatagctctcatagcttcatgtatccacatcacaaactggagcac |
8893659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University