View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14386_low_9 (Length: 308)
Name: NF14386_low_9
Description: NF14386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14386_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 13616442 - 13616711
Alignment:
| Q |
20 |
ttctatgttgagaagaatgatgatggtaggagctttagagacctattgcttttgatttagtaaatgctgttaaaagttgtgtgtttccttattcaaattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616442 |
ttctatgttgagaagaatgatgatggtaggagctttagagacctattgcttttgatttagtcaatgctgttaaaagttgtgtgtttccttattcaaattt |
13616541 |
T |
 |
| Q |
120 |
tttgaaggctagtattgaacataacccaatttttgtgaagaggagattgtgttctacataattttttgctagggaaggaagtcgatgtgaagggtgataa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13616542 |
tttgaaggctagtattgaacataacccaatttttgtgaagaggagattgtgttctacataattttttgctagggaaggaagtcgatatgaagggtgataa |
13616641 |
T |
 |
| Q |
220 |
tatttctctttggaacgatagatggttaagtgatggctcgttgctagatggtcttattgatatccctagt |
289 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13616642 |
tatttctctttggaatgatagatggttaagtgatggctcgttgctagatggtcttattgatatccctagt |
13616711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University