View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14387_high_14 (Length: 279)
Name: NF14387_high_14
Description: NF14387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14387_high_14 |
 |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0204 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 5766 - 5574
Alignment:
| Q |
1 |
cataatctttctaagacataaatcatgcaataatttaaatatcaaactggaaattgaactgacgagaccttcaagtcatggttcatttgccttaaagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5766 |
cataatctttctaagacataaatcatgcaatagtttaaatatcaaacttgaaattgaactgacgagaccttcaagtcatggttcatttgccttaaagcat |
5667 |
T |
 |
| Q |
101 |
ttaaacatagatgaaactgtggttgaacggttcaaataactgaacaatggacaatggcagttaacttcggtttgatttttaaagaacacagaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5666 |
ttaaacatagatgaaactgtggttgaacggttcaaataactgaacaatggacaatggcagttaacttcggtttgatttttaaagaacacagaa |
5574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University