View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14387_high_16 (Length: 229)
Name: NF14387_high_16
Description: NF14387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14387_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 40311885 - 40311690
Alignment:
| Q |
18 |
gtatcaatgtcatgtccagtatctatgtcattgctatagaaatagaaatgcataacaatctcaagttttcaaaaacaacattaaaagtacacaaaaaaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40311885 |
gtatcaatgtcatgtccagtatctatgtcattgctatagaaatagaaatgcataacaatctcaagttttcaaaaacaacattaaaagtacaaaaa----- |
40311791 |
T |
 |
| Q |
118 |
ttaaaggaaatgaagactcaccctatcacagcccggcacaagttgctgcaatatcttcattctttcacttattttctctcttctcacctgaaatccattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311790 |
ttaaaggaaatgaagactcaccctatcacagcccggcacaagttgctgcaatatcttcattctttcacttattttctctcttctcacctgaaatccattt |
40311691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Complemental strand, 45176021 - 45175953
Alignment:
| Q |
141 |
tatcacagcccggcacaagttgctgcaatatcttcattctttcacttattttctctcttctcacctgaa |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
45176021 |
tatcacagcctggcacaagttgctgcaacttcttcatcctttcacttattttctctcttcttacctgaa |
45175953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University