View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14387_low_16 (Length: 279)

Name: NF14387_low_16
Description: NF14387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14387_low_16
NF14387_low_16
[»] scaffold0204 (1 HSPs)
scaffold0204 (1-193)||(5574-5766)


Alignment Details
Target: scaffold0204 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 5766 - 5574
Alignment:
1 cataatctttctaagacataaatcatgcaataatttaaatatcaaactggaaattgaactgacgagaccttcaagtcatggttcatttgccttaaagcat 100  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5766 cataatctttctaagacataaatcatgcaatagtttaaatatcaaacttgaaattgaactgacgagaccttcaagtcatggttcatttgccttaaagcat 5667  T
101 ttaaacatagatgaaactgtggttgaacggttcaaataactgaacaatggacaatggcagttaacttcggtttgatttttaaagaacacagaa 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5666 ttaaacatagatgaaactgtggttgaacggttcaaataactgaacaatggacaatggcagttaacttcggtttgatttttaaagaacacagaa 5574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University