View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14389_high_14 (Length: 355)
Name: NF14389_high_14
Description: NF14389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14389_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 141 - 338
Target Start/End: Original strand, 55208461 - 55208658
Alignment:
| Q |
141 |
gatctgaatgaatatgtcaactgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatcatgtctatgccaacactaagtataac |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208461 |
gatctgaatgaatatgtcaattgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatcatgtctatgccaacactaagtataac |
55208560 |
T |
|
| Q |
241 |
aacaatcaacagagggacgaggttgatcgctttttaatatcacaggttattagttattagttttcccttttcaattttaatatacatatgtaatcatc |
338 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208561 |
aacaatcaacagagcgacgaggttgatcgctttttaatatcacaggttattagttattagttttcccttttcaattttaatatacatatgtaatcatc |
55208658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 12 - 92
Target Start/End: Original strand, 55208332 - 55208415
Alignment:
| Q |
12 |
cccgccgttaaaccctcaaactaattaaactccttttat---tattattattgtacgttataatatatgtgggttgagaaacgc |
92 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208332 |
cccgccgttagaccctcaaactaattaaactccttttattattattattattgtacgttataatatatgtgggttgagaaacgc |
55208415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University