View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14389_high_17 (Length: 300)
Name: NF14389_high_17
Description: NF14389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14389_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 7348336 - 7348065
Alignment:
| Q |
10 |
agaacctgtgatgattgtaattgataagatacgtcaggagagggaggtatctccgttggataatcttctgaagattttgaagtatttgaaagggaaattt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7348336 |
agaaccggtgatgattgtaattgataagttacgtcaggagagggaggtatctccgttggataatcttttgaagattttgaagtatttgaaagggaaattt |
7348237 |
T |
|
| Q |
110 |
gaaactatcagagatgacattcaagctgtggaggatagagtcaaattcctccaaaattttctgctggcttatctcaagtcatcaaaatcttcatcttctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7348236 |
gaaactatcagagatgacattcaagctgtggaggatagagtcaagtgcctccaaaattttctgctggcttatctcaagtcatcaaaatcttcatcttctt |
7348137 |
T |
|
| Q |
210 |
agttattatgattatcaatggtttcattttgcttttaatctcttttgaaaagttgcaacttctcgtttatta |
281 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7348136 |
agttattatgatcatcaatggtttcattttgcttttaatctcttttgaaaagttgcaacttctcgtttatta |
7348065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 277
Target Start/End: Complemental strand, 7365498 - 7365402
Alignment:
| Q |
178 |
ttatctcaagtcatcaaaatcttcatcttcttagttattatgattatcaatggtttcattttgcttttaatctcttttgaaaagttgcaacttctcgttt |
277 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
7365498 |
ttatctcaaatcagcaacatcttcatcttctcagttat---gattatcaatggtttcgttttgcttttaatctcttttgaaatgttgcaacttctggttt |
7365402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 7373369 - 7373321
Alignment:
| Q |
167 |
tttctgctggcttatctcaagtcatcaaaatcttcatcttcttagttat |
215 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
7373369 |
tttctgctggtttatctcaagtcagcaaaatcttcatcttctcagttat |
7373321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University