View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14389_high_22 (Length: 220)
Name: NF14389_high_22
Description: NF14389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14389_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 30 - 186
Target Start/End: Complemental strand, 39275309 - 39275153
Alignment:
| Q |
30 |
ggatcgagtatcaataaattgtgtgctttgtttgctgttttcatattttaataagttgccctgattataaatggtgcttcatatatatgatcaatgttat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39275309 |
ggatcgagtatcaataaattgtgtgctttgtttgctgttttcatattttaataatttgccctgattataaatggtgcttcctatatatgatcaatgttat |
39275210 |
T |
 |
| Q |
130 |
ctgtaactcattctgaagctatggaatatatgaacctttatatatatgatatgatta |
186 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || |||||||||||| |||||||| |
|
|
| T |
39275209 |
ctgtaactcattctgaagctatgaaatatatggacttttatatatatgttatgatta |
39275153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University