View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14389_low_24 (Length: 215)
Name: NF14389_low_24
Description: NF14389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14389_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 8383395 - 8383581
Alignment:
| Q |
16 |
cactatggtgccaaacaacaacacgacatgaacatattggttataacaaaaatgtttcatagatttgaaaatcccaaaaaagtgatttaatttagtgtgt |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8383395 |
cactatggtaccaaacaacaacacgacatgaacatattggttataccaaaaatgtttcatagatttgaaaatcccaaaaaagtgatttaatttagtatgt |
8383494 |
T |
 |
| Q |
116 |
caattgatggcatattggacaccgagacattggtgttcgacaatacgtgacttattgattacattcaattacttatatcttcttctc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8383495 |
caattgatggcatattggacaccgagacattggtgttcgacaatacgtgacttattgattacattcaattacttatatcttcttctc |
8383581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University