View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1438_high_12 (Length: 236)
Name: NF1438_high_12
Description: NF1438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1438_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 5 - 219
Target Start/End: Original strand, 47625202 - 47625416
Alignment:
| Q |
5 |
aaaaccttaacactgttctgttttcactttcttccaacgtaaccaatgatgttagatttttcaacacaacatcaggaaatgattcaaacaaagtctatgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625202 |
aaaaccttaacactgttctgttttcactttcttccaacgtaaccaatgatgttagatttttcaacacaacatcaggaaatgattcaaacaaagtctatgg |
47625301 |
T |
|
| Q |
105 |
tctctatatgtgtcgtggagatgttccatttgctctatgcagagagtgtattggttttgcaacacaaaaaattccatcatcttgtccttcttctaaagaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625302 |
tctctatatgtgtcgtggagatgttccatttgctctatgcagagagtgtattggttttgcaacacaaaaaattccatcatcttgtccttcttctaaagaa |
47625401 |
T |
|
| Q |
205 |
gctgtgatctggtac |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47625402 |
gctgtgatctggtac |
47625416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University