View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1438_low_17 (Length: 218)
Name: NF1438_low_17
Description: NF1438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1438_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 100 - 181
Target Start/End: Original strand, 31396438 - 31396519
Alignment:
| Q |
100 |
aagacaaagggggagaacaagtgctgtgtgaacaatacaatagtgtctacttataaatgtgtattgtgaacaatacttttta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31396438 |
aagacaaagggggagaacaagtgctgtgtgaacaatacaatagtgtctacttataaatgtgtattgtgaacaatacttttta |
31396519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 31396307 - 31396343
Alignment:
| Q |
1 |
ttttgttttgtttacttgtcaagtcttatttgtacct |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31396307 |
ttttgttttgtttacttgtcaagtcttatttatacct |
31396343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University