View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1438_low_9 (Length: 349)

Name: NF1438_low_9
Description: NF1438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1438_low_9
NF1438_low_9
[»] chr3 (1 HSPs)
chr3 (22-61)||(33328435-33328474)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 61
Target Start/End: Original strand, 33328435 - 33328474
Alignment:
22 gaagatgcatacgcgtggatcttgagtacataatatttca 61  Q
    ||||||||||| ||||||||||||||||||||||||||||    
33328435 gaagatgcatatgcgtggatcttgagtacataatatttca 33328474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University