View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14390_high_3 (Length: 494)

Name: NF14390_high_3
Description: NF14390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14390_high_3
NF14390_high_3
[»] chr2 (1 HSPs)
chr2 (246-289)||(45447082-45447125)


Alignment Details
Target: chr2 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 246 - 289
Target Start/End: Original strand, 45447082 - 45447125
Alignment:
246 ttgcaccattgtccgcaatgcttgaaactaaatatgcagaacat 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
45447082 ttgcaccattgtccgcaatgcttgaaactaaatatgcagaacat 45447125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University