View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14390_high_3 (Length: 494)
Name: NF14390_high_3
Description: NF14390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14390_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 246 - 289
Target Start/End: Original strand, 45447082 - 45447125
Alignment:
| Q |
246 |
ttgcaccattgtccgcaatgcttgaaactaaatatgcagaacat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45447082 |
ttgcaccattgtccgcaatgcttgaaactaaatatgcagaacat |
45447125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University