View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14390_low_11 (Length: 365)
Name: NF14390_low_11
Description: NF14390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14390_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 125 - 338
Target Start/End: Complemental strand, 13203697 - 13203490
Alignment:
| Q |
125 |
ataggttgtatctaataattatctaaaactgagttttcattttgcatgatgaaagtaaagtagtaaacttgaataatatattttcccgagggtttggcat |
224 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13203697 |
ataggttgtatctaataaatatctaaaactgagttttcattttgcatgatgaaagta-----gtaaacttgaataatatattttcccgagggtttggcat |
13203603 |
T |
|
| Q |
225 |
tttgtaggtcacaaggttgataagggtggcgttattccacaagatgtttcaccaaccaacaaacgacgtttgccagcaggtcttagaggtacacatacac |
324 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13203602 |
tt-gtaggtcacaaggttgataagggtggcgttattccacaagatgtttcaccaaccaacaaacgtcgtttgccagcaggtcttagaggtacacatacac |
13203504 |
T |
|
| Q |
325 |
acatgcatgcatgc |
338 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13203503 |
acatgcatgcatgc |
13203490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 17 - 118
Target Start/End: Complemental strand, 13204106 - 13204006
Alignment:
| Q |
17 |
attaagtatgtcccgtccgacaggacattcacacatataatttatattaaattaagtaattttctcaaattatcggtgtcagtgtgttagcgtgtccgtg |
116 |
Q |
| |
|
||||||||||||| |||||||| |||| | ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13204106 |
attaagtatgtcctgtccgacacgacactgacacatatagtt-atattaaattatgtaattttctcaaattatcggtgtcagtgtgttagcgtgttcgtg |
13204008 |
T |
|
| Q |
117 |
ct |
118 |
Q |
| |
|
|| |
|
|
| T |
13204007 |
ct |
13204006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University