View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14390_low_17 (Length: 236)
Name: NF14390_low_17
Description: NF14390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14390_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 9927022 - 9927226
Alignment:
| Q |
17 |
aattaagattgaatattgttcattaaaccagatagagacataagatgcttgagattcagcctatacttttaattacagatacactgggatgtataaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9927022 |
aattaagattgaatattgttcattaaaccagatagagacataagatgcttgagattcagcctatacttttaattacagatacactgggatgtataaaatg |
9927121 |
T |
 |
| Q |
117 |
atcgacccatttcagatctcacaagatttttgtctcctgcacgtgcatgtagccttcaatttatttcatctccttactgtttttcactatgacacgtagt |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9927122 |
atcgacccatttcagatttcacaagatttttgtctcctgcacgtgcatgtagccttcaatttatttcatctccttactgtttttcactatgacacgtagt |
9927221 |
T |
 |
| Q |
217 |
atatt |
221 |
Q |
| |
|
||||| |
|
|
| T |
9927222 |
atatt |
9927226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University