View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14391_low_6 (Length: 270)
Name: NF14391_low_6
Description: NF14391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14391_low_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 32666712 - 32666979
Alignment:
| Q |
20 |
tgatgccgataataaaactcattagtgtcatagtgtgcactttcttgttataactcgcatgagaaccttctcatatctctaagtgtgtgttct------- |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32666712 |
tgatgctgataataaaactcattagtgtcatagtgtgcactttcttgtta--actcgcatgagaaccttctcatctctctaagtgtgtgttctcaattgt |
32666809 |
T |
|
| Q |
113 |
-----aacatctaatggtaaaaaccactcttacaaggttctaca-------ccaaaatcacttgtgtacatagattttgtcccatcattctttcaatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666810 |
gttctaacatctaatggtaaaaaccactcttacaaggttctacaatctacacaaaaatcacttgtgtacatagattttgtcccatcattctttcaatttt |
32666909 |
T |
|
| Q |
201 |
gatatctgtgactacactttcgcccatccttcccataccctaactcaatctaatgaacattctctcttgt |
270 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666910 |
gatatctgtgactacacttttgcccatccttcccataccctaactcaatctaatgaacattctctcttgt |
32666979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University