View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_high_32 (Length: 400)
Name: NF14392_high_32
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 9e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 10 - 168
Target Start/End: Complemental strand, 31279216 - 31279058
Alignment:
| Q |
10 |
aacaatatcttatttttggtgattaaaattcatatttttatcttggttttgctttctgaaacttgtcatggtttatttgaaaagacaacaattctggtga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31279216 |
aacaatatcttatttttggtgattaaaaatcatatttttatcttggttttgctttctgaaacttgtcatggtttatttgaaaagacagcaattctggtga |
31279117 |
T |
 |
| Q |
110 |
tttcattttattttgacaggaagaatgttttcttgatgttcataatgttcttgatgcat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279116 |
tttcattttattttgacaggaagaatgttttcttgatgttcataatgttcttgatgcat |
31279058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 248 - 387
Target Start/End: Complemental strand, 31278978 - 31278839
Alignment:
| Q |
248 |
ggcattgtctatttcgacaaatttgatgtattttcaatcactactttttgtgggtattagtaaatctttgcgggcaagaagcttggagaaggaaacgtaa |
347 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31278978 |
ggcattgtctatttcgtcaaatttgatgtattttcaatcactactttttgtgggtattagtaaatctttgcgggcaagaagcttggagaaggaaacgtaa |
31278879 |
T |
 |
| Q |
348 |
gaagtatagttcgcattttatctggtgaaatagttattaa |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31278878 |
gaagtatagttcgcatgttatctggtgaaatagttattaa |
31278839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University