View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_high_39 (Length: 361)
Name: NF14392_high_39
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_high_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 23193154 - 23193498
Alignment:
| Q |
1 |
gatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttcccttatgtctttcagagacatggaatgcaatggaaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193154 |
gatacactggccgtttaggacgaagtcgggatcaaggggttgggaccctgaggtcatggttcccttatgtctttcagagacatggaatgcaatggaaggt |
23193253 |
T |
|
| Q |
101 |
ttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaagacttactcggatatgctaagattccgccagcagtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193254 |
ttattcgcctcaggtcaagcacgtgcgattggtgtcagcaacttttcaactaagaagcttcaagacttactcggatatgctaagattccgccagcagtta |
23193353 |
T |
|
| Q |
201 |
accaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactggtgttcatctcacggtaataccctgactaagattgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23193354 |
accaagttgaatgccatcctgtttggcaacaaccagctcttcataatttgtgcaattctactggtgttcatctcacggtaataccctgactaagattgat |
23193453 |
T |
|
| Q |
301 |
atagtatagtctgaaccagttttggtctttaatagatcaaatttt |
345 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
23193454 |
atagtatagtccgaacgagttttggtctttaatagatcaaatttt |
23193498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University