View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14392_high_50 (Length: 302)

Name: NF14392_high_50
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14392_high_50
NF14392_high_50
[»] chr3 (1 HSPs)
chr3 (181-263)||(26854889-26854971)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 181 - 263
Target Start/End: Original strand, 26854889 - 26854971
Alignment:
181 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccactttgacgtatatccacaatct 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
26854889 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccagtttgacgtatatccacaatct 26854971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University