View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_high_50 (Length: 302)
Name: NF14392_high_50
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 181 - 263
Target Start/End: Original strand, 26854889 - 26854971
Alignment:
| Q |
181 |
cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccactttgacgtatatccacaatct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26854889 |
cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccagtttgacgtatatccacaatct |
26854971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University